Create your own FROGS databank

metabarcoding
FROGS
command line
migale
Author
Affiliation

Olivier Rué

Migale bioinformatics faciliy

Published

March 14, 2023

Modified

September 1, 2026

Introduction

FROGS [1], [2] is a user-friendly and Galaxy-supported pipeline.

It allows to analyze large sets of DNA amplicons sequences accurately and rapidly, essential for microbe community studies.

Among the many tools available, a tool called taxonomic_affiliation returns taxonomic affiliation for each ASV using Blast [3] or RDP [4]. A lot of databanks are available and are formatted by us.

In this document, we show you how to make your own databank for FROGS. You will need to have rdp_classifier-2.13 [4], blast [3] and FROGS [1] installed.

How to use a custom databank?

Sometimes, you need to use a databank which is not availabe among those we provide. Depending on whether you use FROGS from the command line or via Galaxy, the problem is not the same.

Command line

In command line, you need to choose the affiliation databank to use, by indicating the sequence reference fasta file with the option --reference. You can therefore use your own databank, on condition that it is well formatted!

Galaxy

With Galaxy, you have to chose a databank among a list of available databanks. You can’t chose another one without asking administrators to add it.

Figure 1: Drop-down menu to select a databank from the server
Warning

A databank available in Galaxy is accessible by all the users of this instance.

Prerequites for a FROGS databank

Four informations are mandatory to build a FROGS databank:

  1. a name and a version
  2. some nucleic sequences (the targeted region of interest)
  3. a unique identifier for each sequence
  4. a taxonomy for each sequence

Name and version

As the content of the banks is constantly evolving, it is essential to specify the version. It can be a number, a date…

The sequence

Only A, C, G, T or N characters are authorized (nucleotidic sequence). The length is not important.

The header of the sequences

Each sequence must have a unique identifier.

The taxonomic ranks

A FROGS databank needs each sequence to have the exact same number of taxonomic ranks. The classical 7 ranks are:

Phylum Class Order Family Genus Species

but can also be:

Phylum Class Order Family Genus Species Strain

The taxonomy can be written following the Greengenes taxonomy:

k__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Slackia;s__Slackia_heliotrinireducen

or not:

Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Slackia;Slackia_heliotrinireducen

Prepare the raw files

To format a databank, you will need to create two files. One containing the taxonomic ranks (called here taxonomies.tsv), the other one containing the sequences (sequences.fasta).

Example:

  • taxonomies.tsv
SEQ1    Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Slackia;Slackia_heliotrinireducen
SEQ2    Bacteria;Actinobacteria;Coriobacteriia;Coriobacteriales;Coriobacteriaceae;Slackia;Slackia_exigua
  • sequences.fasta
>SEQ1
ATTCCTTGGAGGTGAGGTGCGGGCGCGAG
>SEQ2
TTTCCTTGGAGGTGAGGTGCGGGCGCCCC

You can add the databank name and version in the filename.

DB_NAME="MYDB"
DB_VERSION="MYVERSION"
mkdir ${DB_NAME}_${DB_VERSION}
FASTA=${DB_NAME}_${DB_VERSION}.fasta
TAX=${DB_NAME}_${DB_VERSION}.tax

Index files for FROGS

Check the consistency of the raw files

First, a verification is necessary to ensure that the files are as expected.

grep -c '>' $FASTA
2
wc -l $TAX
2

Check all sequences have a taxonomy

grep '>' $FASTA | sed 's/>//' | awk -v T=$TAX 'BEGIN{while(getline<T>0){tab[$1]=1}}{if(tab[$1]!=1){print $1}}' > no_tax.txt
wc -l no_tax.txt
0

Check all taxonomies harbor the same ranks number

cut -f 2 $TAX |awk -F ";" '{print NF}' | sort -u
7
Note

The result is 7 if your taxonomies have 7 ranks, but can be 6, 8…

Check the N rate

cat  $FASTA |awk -F "N" '{if(substr($1,0,1) == ">"){split($1,tab," "); id=tab[1]}else{count=NF-1; print id"\t"count"\t"length($0)"\t"count*100/length($0)}}' > count_N.txt
cat count_N.txt | awk '{c++; if($4>40){m++}}END{print m"/"c"="m*100/c"%"}'
Note

It is a recommandation of Blast to have a small proportion of N’s in the sequences.

RDP files

The script fasta2RDP.py (available in FROGS sources) allows to generate mandatory files for RDP.

fasta2RDP.py -d $FASTA -t $TAX -r R1 R2 R3 R4 R5 R6 R7 --rdp-taxonomy ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.tax --rdp-fasta ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.fasta

The -r option allows to precise the rank names. These names do not have any impact on the rank names used in FROGS. However, there must be as many as the number of ranks.

conda activate frogs-4.1.0
conda_lib_dir=`echo $(dirname $(dirname $(which preprocess.py)))/libexec`
export PATH=$conda_lib_dir:$PATH
#export PATH="/home/orue/work/GIT/FROGS2023OK/libexec":$PATH
export PYTHONPATH=`echo $(dirname $(dirname $(which preprocess.py)))/lib`:$PYTHONPATH

fasta2RDP.py -d $FASTA -t $TAX -r R1 R2 R3 R4 R5 R6 R7 --rdp-taxonomy ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.tax --rdp-fasta ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.fasta

conda deactivate

The following commands allow to check if problematic taxa are found. Problematic taxa are:

  • duplicated taxon
  • a taxon name used at different ranks or used at the same rank but with different kinship
cut -f 2 -d '*' ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.tax  |  cut -f 1 -d ' ' | sort | uniq -c | awk '$1!=1 && $2 !="unclassified"' > problematic_taxon
if [[ -e problematic_taxon_and_rank_number ]]
then
rm problematic_taxon_and_rank_number
fi
for i in `awk '{print $2}' problematic_taxon `
do 
exp=`echo \"\*$i \[id\"`
grep "\*"$i" \[id" ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.tax | sed 's/ \[id/*/'| awk -F "*" '{print $2,$5}' >> problematic_taxon_and_rank_number
done

Then, the tool classifier.jar of the rdp tools is run:

java -Xmx60g -jar classifier.jar train -o . -s ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.fasta -t ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.tax
conda activate rdp_classifier-2.13 && java -Xmx60g -jar /usr/local/genome/Anaconda3/envs/rdp_classifier-2.13/share/rdp_classifier-2.13-1/classifier.jar train -o . -s ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.fasta -t ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.tax && conda deactivate

The following files must be created in the ${DB_NAME}_${DB_VERSION}/ directory:

bergeyTrainingTree.xml
logWordPrior.txt
wordConditionalProbIndexArr.txt
genus_wordConditionalProbList.txt

A file called ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.fasta.properties needs to be added manually. You can copy its content (with the correct version of rdp):

# Sample ResourceBundle properties file
bergeyTree=bergeyTrainingTree.xml
probabilityList=genus_wordConditionalProbList.txt
probabilityIndex=wordConditionalProbIndexArr.txt
wordPrior=logWordPrior.txt
classifierVersion=RDP Naive Bayesian rRNA Classifier Version 2.5, May 2012 

BLAST files

For BLAST, the tool makeblastdb is used:

makeblastdb -in ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.fasta -dbtype nucl
conda activate blast-2.13.0 && makeblastdb -in ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.fasta -dbtype nucl && conda deactivate

Test your databank

You can download test files from FROGS github repository:

wget https://github.com/geraldinepascal/FROGS/raw/dev/tools/taxonomic_affiliation/data/swarm.fasta
wget https://github.com/geraldinepascal/FROGS/raw/dev/tools/taxonomic_affiliation/data/swarm.biom

and run taxonomic_affiliation.py:

conda activate frogs-4.1.0 && taxonomic_affiliation.py --rdp --reference ${DB_NAME}_${DB_VERSION}/${DB_NAME}_${DB_VERSION}.fasta --input-biom swarm.biom --input-fasta swarm.fasta --output-biom affiliation.biom --summary affiliation.summary && conda deactivate
Note

Example files come from a 16S analysis. You may not have affiliations in the output files if your marker gene of interest is not 16S. Nevertheless, the program should not return an error

Availiablily of your databank

Metadata

It is important to add a licence and a README file to explain how was built your databank and how it can be reused by others.

touch ${DB_NAME}_${DB_VERSION}/LICENCE.txt
# and write informations
touch ${DB_NAME}_${DB_VERSION}/readme.txt
# and write informations

Finally, create an archive containing all files:

tar -cvzf ${DB_NAME}_${DB_VERSION}.tar.gz ${DB_NAME}_${DB_VERSION}

Share it through FROGS website

If you want to make your databank available for all users, you can send the archive at frogs-support@inrae.fr. We will add it to the available databanks and Galaxy administrators will be able to easily add it to their instance via the FROGS data manager.

Display it in LEAP

If you want to make your databank available in LEAP, you can ask us. It will be done several days after availability in FROGS.

References

1. Escudié F, Auer L, Bernard M, Mariadassou M, Cauquil L, Vidal K, et al. FROGS: Find, Rapidly, OTUs with Galaxy Solution. Bioinformatics. 2018;34:1287–94. doi:10.1093/bioinformatics/btx791.
2. Bernard M, Rué O, Mariadassou M, Pascal G. FROGS: a powerful tool to analyse the diversity of fungi with special management of internal transcribed spacers. Briefings in Bioinformatics. 2021;22. doi:10.1093/bib/bbab318.
3. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of molecular biology. 1990;215:403–10.
4. Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied and environmental microbiology. 2007;73:5261–7.

A work by Migale Bioinformatics Facility
Université Paris-Saclay, INRAE, MaIAGE, 78350, Jouy-en-Josas, France
Université Paris-Saclay, INRAE, BioinfOmics, MIGALE bioinformatics facility, 78350, Jouy-en-Josas, France